The Species of Diversity of Sredniy Kaban Lake by 18s Rrna of Hydrobionts on next-Generation Sequecing Method

Journal of Environmental Treatment Techniques

2019, Special Issue on Environment, Management and Economy, Pages: 1030-1035

J. Environ. Treat. Tech.

ISSN: 2309-1185

Journal web link: http://www.jett.dormaj.com

The Species of Diversity of Sredniy Kaban Lake

by 18s Rrna of Hydrobionts on next-Generation

Sequecing Method

Anthony Elias Sverdrup, Ludmila L. Frolova*

Institute of Fundamental Medicine and Biology, Kazan Federal University, Kazan, Russia

Received: 05/08/2019

Accepted: 20/11/2019

Published: 20/12/2019

Abstract

The paper presents the freshwater Sredniy Kaban Lake species diversity study results, (Kazan, Russia) by the 18S rRNA gene

based on the next-generation sequencing method. Lakes Sredniy Kaban, Verhniy Kaban, and Nizhniy Kaban are included in the

system of urban lakes Kaban and are polluted lakes according to ecological studies. Sequences of 18S rRNA gene fragment of

freshwater Sredniy Kaban lake hydrobionts in FASTQ format were submitted to international SRA database on the NCBI

website SRR7510987, SRR7465570, SRR7516496 A total of 44292 (2016) and 36631 (2017) high-quality reads were obtained;

13.1% (2016) and 58% (2017) of the hydrobionts was classified to the kingdom, while 12.75% (2016) and 57.6% (2017) was

classified to the phylum level, 12.7% (2016) and 56.6% (2017) was classified to the class level, 7.9% (2016) and 56.2% (2017)

was classified to the order level, 56.1% (2017) was classified to the family level, 56% (2017) was classified to the genus level,

and 54.7% (2017) was classified to the species level. The analysis of the metagenomic data for Sredniy Kaban Lake shows that

indicator organisms identified by the 18S rRNA gene are grouped between o-saprobity and b-mesosaprobity. Sredniy Kaban

Lake can be characterized by water quality as a transition from a polluted to a clean state.

Keywords: Saprobity, gene 18S rRNA, Next-generation sequencing, Freshwater lake, Ecology

the systematic position of the body and the time of

Introduction

discrepancy with similar species based on the analysis of

similarities and differences in rRNA sequences (4). For

eukaryotes, it is most convenient to analyze 18S rRNA of

the three types of rRNA. The paper presents the results of

the study of the species diversity of the freshwater Sredniy

Kaban Lake (Kazan, Russia) by 18S rRNA gene of

freshwater organisms based on the next-generation

sequencing method. Lakes Sredniy Kaban, Verhniy Kaban,

and Nizhniy Kaban are included in the system of urban

lakes Kaban. According to ecological studies, Kaban Lakes

are polluted lakes.

Sredniy Kaban Lake is included in the system of city

lakes Kaban along with lakes Verhniy Kaban and Nizhniy

Kaban. On shore of Sredniy Kaban Lake, there is a rowing

center, which is a place for training athletes in all types of

rowing. According to ecological studies, Sredniy Kaban

Lake is a polluted lake.

One of the methods for assessing the ecological state of

water reservoirs is the bioindication method (1).

Traditionally, the identification of species in a water sample

is carried out visually using

microscope. The

development of modern methods of molecular genetics and

bioinformatics allows identifying organisms by marker

genes. Currently, next-generation sequencing methods

have gained rapid development. Metagenomics can provide

valuable information on the functional ecology of

environmental communities (2). We previously used

metagenomic DNA sequencing to analyze species diversity

by СО1 marker gene of animal organisms to assess the

ecological status of freshwater Sredniy Kaban Lake by

bioindication (3). In contrast to the marker genes СО1 and

rbcL, 18S rRNA gene is present in all eukaryotes. This is

one of the most conserved genes that is used to determine

2 Methods

Sampling from Sredniy Kaban Lake (Kazan, Russia)

was carried out in 2016-2017 in accordance with the

standard hydrobiological methods (5). DNA isolation from

the sediment obtained by centrifugation of 50 ml of the

sample at a speed of 10000 g for 15 min was carried out

using a set of FAST DNA Kit (MP biomedicals) according

to the manufacturer's Protocol. Amplification of the

extracted DNA was carried out by the Phusion High-

Fidelity DNA polymerase (Thermo Fisher) using primers

(

Table 1).

The second PCR cycle was performed to index samples

Nextera XT indices). Purification of PCR products was

Corresponding author: Ludmila L. Frolova, Kazan

Federal University. E-mail: Lucie.Frolova@gmail.com.

(

1030

Journal of Environmental Treatment Techniques

2019, Special Issue on Environment, Management and Economy, Pages: 1030-1035

performed using Agencourt AMPure XP beads (Beckman

Coulter). The obtained DNA libraries were sequenced on

an Illumina MiSeq equipment (MiSeq Reagent kit v3).

Metagenomic data were submitted to the international SRA

database on the NCBI website with the numbers

SRR7510987, SRR7465570, SRR7516496 (6). After

filtering reads by quality, trimming of service sequences,

and removing chimeric sequences, obtained nucleotide

sequences of the hydrobionts’ 18S rRNA gene were aligned

with the BLAST program to determine the taxonomic

composition. The Krona chart (7) and GraphPad (8)

software are used for charting.

Kaban Lake, there is a large sports complex - the Rowing

Sports Center. According to ecological studies, Sredniy

Kaban Lake is a polluted lake.

Table 1: Primers for PCR of 18S rRNA gene

Primers

Sequences

SR1_Illum tcgtcggcagcgtcagatgtgtataagagacagattaccgcgg

ina

ctgct-3'

Figure 1: Sredniy Kaban Lake (Kazan city, Russia)

https://www.sport-line.ru/objects/grebnye-kanaly/76/]

[

SR1r_Illu

mina

gtctcgtgggctcggagatgtgtataagagacagtacctggttg

atqctgccagt-3'

3.1 Krona chart of the hydrobionts represented by 18S

rRNA gene amplicon-based species diversity

The percentage distribution of hydrobionts of Sredniy

Kaban Lake by reads for 2016, (Unclassified 87%) is

shown in Fig. 2. Percentage distribution of hydrobionts of

Sredniy Kaban Lake by reads for 2017, (Unclassified 42%)

is shown in Fig. 3. Each circle represents the kingdom,

phylum, class, order, family, genus, and species from the

inside to the outside of the circle, respectively, indicated by

percentage of diversity.

Results and Discussion

In 2016-2017 the next-generation sequencing method

was used to identify hydrobionts by 18S rRNA gene from

Sredniy Kaban Lake. It is a lake about 3 km in length and

.6 km in wide and has the geographical coordinates -

5.750352°N and 49.146739°E (Fig. 1). Sredniy Kaban

Lake is located in the center of an industrial city, thus

experiencing anthropogenic stress. On the shore of Sredniy

Figure 2: The percentage of 18S rRNA hydrobionts by reads of Sredniy Kaban Lake (2016)

1031

Journal of Environmental Treatment Techniques

2019, Special Issue on Environment, Management and Economy, Pages: 1030-1035

Figure 3: The percentage of 18S rRNA hydrobionts by reads of Sredniy Kaban Lake (2017)

.2 The percentage of 18S rRNA hydrobionts by reads

2017) shown in Figure 5. As can be seen in Fig. 5 among

the hydrobionts, the most numerous according to the reads

are Chromista (96.31% / 55.76%) and Metazoa - 43.6%

(2017).

of Sredniy Kaban Lake (2016)

The percentage of species diversity of 18S rRNA

hydrobionts of Sredniy Kaban Lake by kingdom (2016-

2017), shown in Figure 4. As can be seen from Fig. 4, the

most numerous at the kingdom level, respectively, by year

are Chromista (90.48%/51.90%), Metazoa (4.76%/29.52%)

and Viridiplantae – 9.52% (2017) by species diversity.

Figure 5: The percentage of 18S rRNA hydrobionts by reads of

Sredniy Kaban Lake (2017)

3.3 The percentage of 18S rRNA hydrobionts by reads

of Sredniy Kaban Lake (2016)

The percentage of species diversity of 18S rRNA

hydrobionts of Sredniy Kaban Lake by kingdom (2016-

Figure 4: The percentage of species diversity of 18S rRNA

hydrobionts of Sredniy Kaban Lake by kingdom (2016-2017),

shown in Figure 4

2017), shown in Figure 5. As can be seen from Fig. 6, the

most numerous at the phylum level for 2016 are

Cryptophyta (8%), Ciliophora (2.5%), Cercozoa (1.2%),

and Unclassified (87%); for 2017 - Dinoflagellata (30%),

The percentage of species diversity of 18S rRNA

hydrobionts of Sredniy Kaban Lake by kingdom (2016-

1032

Journal of Environmental Treatment Techniques

2019, Special Issue on Environment, Management and Economy, Pages: 1030-1035

Arthropoda (23.3%), Ciliophora (1.64%), Rotifera (1.54%)

and Unclassified (42.4%).

Figure 6: The percentage of hydrobionts 18S rRNA of Sredniy

Kaban Lake by types (2016-2017)

3.4 The percentage of 18S rRNA hydrobionts of Sredniy

Kaban Lake by species

The species diversity of hydrobionts in 2017 is 54.7%

in reads of the total number of organisms. Ten hydrobiont

species are included on a top by reads - Ceratium

hirundinella (52.7%), Bythotrephes cederstroemi (15.0%),

Cyclops insignis (3.9%), Chydorus sphaericus (3.3%),

Cyclops kolensis (2.0%), Keratella cochlearis (2.0%),

Acanthocyclops viridis (1.5%), Daphnia pulex (0.5%),

Filinia longiseta (0.5%), Erpobdella obscura (0.4%) (Fig

Figure 7: The species of hydrobionts and reads of Sredniy Kaban

Lake (2017)

7). 140 species from Sredniy Kaban Lake were identified

by 18S rRNA gene. Among them, there are 22 hydrobionts

with saprobities in Sladechek's list (9). Table 2 shows the

saprobionts of Sredniy Kaban Lake.

Crustacea. A common inhabitant of the littoral region

in lakes, frequently found in association with vegetation

(

10).

Table 2: Hydrobionts with saprobities in Sladechek's list of

Sredniy Kaban Lake

2, 9, 10, 14, 17

Diatom, frequently present in brackish water

and oligo-eutrophic freshwater (11,32).

Species

Acroperus harpae , Amphora ovalis ,

Saprobity Reads %

Freshwater invertebrates. It lives along the plant-

covered banks of stagnant and slow-flowing bodies of

water, where it feeds on small fragments of plant material,

animals or carrion. Cyclops can survive unsuitable

conditions by forming a cloak of slime (12).

Cyclops insignis , Leptodora kindtii ,

o-b

3.993

3.515

Tintinnidium fluviatile ,

Simocephalus vetulus

Chydorus sphaericus , Cryptomonas

Leptodora kindtii is a voracious predator and is

curvata , Cocconeis placentula ,

Cymbella cistula , Vorticella

capable of controlling numbers of its preferred prey items,

which are generally juveniles of Daphnia, Bosmina,

Ceriodaphnia, Diaphanosoma, Diaptomus, Polyphemus

mayeri¹¹

_K_e_r_a_t_e_l_l_a_c_o_c_h_l_e_a_r_i_s₁2

b-o

1.954

0.469

and Cyclops (13,34).

Daphnia pulex , Nitzschia palea

Tintinnidium fluviatile

- unicellular organisms,

Brachionus calyciflorus , Coleps

b-a

0.254

0.140

eukaryotes. A review of the ecology of the fresh-water

Tintinnina indicated that water temperature seems to be the

most essential ecologic factor (14).

hirtus , Cymatopleura solea

Acantholeberis curvirostris ,

Alonopsis elongata , Lepadella

_r_h_o_m_b_o_i_d_e_s₂0

The highest frequency of S. vetulus is found in small

_A_c_i_n_e_r_i_a_i_n_c_u_r_v_a_t_a₂1

ponds and ditches. It occurs most commonly in near-neutral

water and is rare in acid water. The conductivity varies

between 0.7–84 mS / m (15).

0.140

0.005

Cyclotella meneghiniana²²

a-b

о – oligosaprobity (clean), o-b, b-o – between oligosaprobity and

b-mesosaprobity, b-mesosaprobity (polluted), a-b – between a-

and b-mesosaprobity, a-mesosaprobity (very polluted), p-

saprobity (dirty)

Inhabit at the bottom of freshwater, sometimes found

in the water column (16,35,36).

Algae, a freshwater species. They are not known to

1033

Journal of Environmental Treatment Techniques

2019, Special Issue on Environment, Management and Economy, Pages: 1030-1035

produce any toxins (17). Cryptomonas are also

photolithotrophs that contribute to oxygenic carbon fixation

making them highly critical to the carbon levels of

freshwater reservoirs (18).

As can be seen from Fig. 8, most indicator organisms

are grouped between о-saprobity and beta-mesosaprobity.

The water quality of Sredniy Kaban Lake is characterized

as a transition from a polluted to a clean state.

Freshwater species of Ciliata. Vorticella habitats

may include moist soil, mud and plant roots. They are

known to feed on bacteria and can also form extracellular

associations with mosquitoes, nematodes, prawns, and

tadpoles (19).

Summary

Based on the results of the study, the next-generation

sequencing method was used to identify hydrobionts by the

gene 18S rRNA for Sredniy Kaban Lake for 2016-2017.

A total of 44292 (2016) and 36631 (2017) high-quality

reads were obtained; 13.1% (2016) and 58% (2017) of the

hydrobionts was classified to the kingdom, while 12.75%

Keratella cochlearis is a rotifer (20). The planktonic

animal occurs worldwide in freshwater and marine habitats.

Daphnia pulex is a species of Crustacea. Daphnia

pulex is an important model species for investigating

ecological stoichiometry (21).

(

2016) and 57.6% (2017) was classified to the phylum

Brachionus calyciflorus is a planktonic rotifer

level, 12.7% (2016) and 56.6% (2017) was classified to the

class level, 7.9% (2016) and 56.2% (2017) was classified

to the order level, 56.1% (2017) was classified to the family

level, 56% (2017) was classified to the genus level, and

species occurring in freshwater. It is commonly used as a

model organism in toxicology, ecology and evolutionary

biology (22).

The C. hirtus does not posess algal symbionts and

54.7% (2017) was classified to the species level.

feeds directly on other microbes (23). Coleps feeds on

bacteria, algae, flagellates, living and dead ciliates, animal

and plant tissues (24,29).

Altogether, 140 species of hydrobionts were identified,

among which Sladechek saprobity was determined for 22

species. Indicator hydrobionts are of the greatest

A. curvirostris is a littoral macrofiltrator. Since it

importance for reads

Chydorus sphaericus, b (3%), Keratella cochlearis, b-o

2%). Thus, the quality of the water of Sredniy Kaban Lake

is between a clean and polluted.

- Cyclops insignis, o-b (4%),

occurs with the highest frequency in acid water, it is used

as an indicator of acid water (pH <5.0). It is most common

in ponds and small lakes, often with a high content of

humus (15).

(

A. elongata is one of the most common littoral

Conclusions

The use of the next-generation sequencing method

species. It occurs in waters of different pH from 3.9 to 8.2.

A. elongata is slightly more common in electrolyte poor

water than in electrolyte-rich water (15).

allows the identification of a large number of hydrobionts.

The method can be used for bioindication in assessing the

ecological status of water reservoirs. The results obtained

are of great practical interest in the field of monitoring of

water objects.

20, 21

Lepadella rhomboids and Acineria incurvata are

species of Ciliata. The ciliates are a group of protozoans

characterized by the presence of hair-like organelles called

cilia (25,30,31).

Cyclotella is a centric diatom. Cyclotella occurs in

Acknowledgments

stagnant waters. The nutrient content does not matter. They

live both floating (plankton) and on the ground (benthos).

C. meneghiniana was firstly described by Kützing (26-

The work is performed according to the Russian

Government Program of Competitive Growth of Kazan

Federal University. The authors would like to thank Dr.

S.Malanin and E.Boulygina, scientists of Kazan Federal

University for their assistance with experimental work.

28,33).

Fig. 8 shows the percentage of saprobionts of Sredniy

Kaban Lake by reads for 2017.

References

. Kurilenko V, Zaitseva OV, Novikova EA, Osmolovskaya NG,

Ufimtseva MD. Fundamentals of ecogeology, bioindication

and bio-testing of aquatic ecosystems. 2003; 448.

. Raes J, Letunic I, Yamada T, Jensen LJ, Bork P. Toward

molecular trait‐based ecology through integration of

biogeochemical, geographical and metagenomic data.

Molecular systems biology. 2011 Jan 1;7(1).

. Khusainov AM, Frolova LL. The Ecological Estimation of

Sredniy Kaban Lake Based on Molecular Methods.

International Journal of Engineering & Technology, 2018;

(4.7): 88-90.

. Lafontaine DL, Tollervey D. Ribosomal rna. e LS. 2001 May

. Bulon VV. Guidelines for the collection and processing of

materials in hydrobiological studies in freshwater reservoirs.

Phytoplankton and its products. L.: State scientific-research

institute of a lake fish farm, 1981; 32.

Figure 8. The percentage of reads by hydrobionts saprobity

of Sredniy Kaban Lake (2017)

. National

Center

for

Biotechnology

Information

http://www.ncbi.nlm.nih.gov/

1034

Journal of Environmental Treatment Techniques

2019, Special Issue on Environment, Management and Economy, Pages: 1030-1035

. Krona homepage - http://github.com/marbl/Krona/wiki

. GraphPadSoftware - https://www.graphpad.com

. Sladechek V. System of water quality from the biological point

of view. Arch. Hydrobiol. Ergeb. Limnol. 1973; 179-191.

of Chemistry-Section A (Theoretical, Engineering and Applied

Chemistry). 2019 Sep 1;2(4, pp. 266-385):296-315.

30. Suganthi A, TK R. Estimation of Anti-dengue Phytochemical

Markers Gallic acid, Rutin and Quercetin in Methanolic

Extract of Euphorbia hirta (L.) and Tawa-Tawa Capsule

Formulation by Validated RP-HPLC Method. Chemical

Methodologies. 2019 Jan 1;3(1. pp. 1-144):43-54.

31. Khan M, Parmar DK, Bhatt HB. Imidazole mediated synthesis

of spirooxindoles in water using isatin as a privileged scaffold.

Asian Journal of Green Chemistry. 2019 Jan 18.

0. Acroperus

harpae

http://cfb.unh.edu/cfbkey/html/Organisms/CCladocera/FChyd

oridae/GAcroperus/Acroperus_harpae/acroperusharpae.html

1. von Berg KH, Hoef-Emden K, Melkonian M. Der kosmos-

algenführer: die wichtigsten süßwasseralgen im mikroskop.

Kosmos; 2004.

2. Cuvelier D, Walter TC. "Cyclops Müller, 1785". World

Copepoda database.

3. A. Herzig, P. Larsson, L.J. Weider, "Cladocera as Model

Organisms in Biology", Hydrobiologia, vol. 307, pp. 273–pp.

32. Powar N, Pandav R. Overview of Borophene as a Potential

Candidate in 2D Materials Science for the Energy

Applications. Journal of Chemical Reviews. 2019 Oct 1;1(4,

pp. 252-350.):271-81.

73-282, 1995.

33. Vinodhkumar G, Ramya R, Potheher I, Cyrac Peter A.

Reduced graphene oxide based on simultaneous detection of

neurotransmitters. Progress in Chemical and Biochemical

Research. 2018 Oct 1;1(1, pp. 1-59):40-9.

4. FOISSNER W, WILBERT N. Morphologie, Infraciliatur und

Ökologie der limnischen Tintinnina: Tintinnidium fluviatile

Stein, Tintinnidium pusillum Entz, Tintinnopsis cylindrata

Daday

und

Codonella

cratera

(Leidy)(Ciliophora,

34. Samimia A, Zarinabadib S, Kootenaeia AH, Azimia A,

Mirzaeia M. Optimization of Naphtha Hydro-Threating Unit

with Continuous Resuscitation Due to the Optimum

Temperature of Octanizer Unit Reactors. development.

1949;16:19.

Polyhymenophora). The Journal of Protozoology. 1979

Feb;26(1):90-103.

5. Norwegian

Biodiversity

Information

Center

https://www.biodiversity.no/

6. Ukhova NL, Olshvang VN. Invertebrate animals of the

Visimsky reserve. The annotated list of species.

Yekaterinburg: “SK Resource”, Raritet Publishing House.

35. Vafaei-Nezhad M, Ghiasi R, Shafiei F. Conformational

Analysis of 2-halo-1, 3, 2-dioxaphosphinanes: A Density

Functional

Theory

(DFT)

Investigation.

Chemical

014; 22.

Methodologies. 2019 Sep 15.

7. Choi B, Son M, Kim JI, Shin W. Taxonomy and phylogeny of

the genus Cryptomonas (Cryptophyceae, Cryptophyta) from

Korea. Algae. 2013;28(4):307-30.

8. Hoef-Emden K, Melkonian M. Revision of the genus

Cryptomonas (Cryptophyceae): a combination of molecular

phylogeny and morphology provides insights into a long-

hidden dimorphism. Protist. 2003 Oct 1;154(3-4):371-409.

9. Patil CD, Narkhede CP, Suryawanshi RK, Patil SV. Vorticella

sp: Prospective Mosquito biocontrol agent. Journal of

arthropod-borne diseases. 2016 Dec;10(4):602.

36. Taghavi Fardood S, Ramazani A, Azimzadeh Asiabi P,

Bigdeli Fard Y, Ebadzadeha B. Microwave-assisted

multicomponent reaction for the synthesis of 2-amino-4H-

chromene derivatives using ilmenite (FeTiO3) as a magnetic

catalyst under solvent-free conditions. Asian Journal of Green

Chemistry. 2017 Jul 1;1(1. pp. 1-55):34-40.

0. Streble H, Krauter D. Das LebenimWassertropfen. Mikroflora

und Mikrofauna des Süßwassers. Kosmos Verlag, Stuttgart.

006.

1. Hall SR, Leibold MA, Lytle DA, Smith VH. Stoichiometry

and planktonic grazer composition over gradients of light,

nutrients, and predation risk. Ecology. 2004 Aug;85(8):2291-

01.

2. Brachionus

https://en.wikipedia.org/wiki/Brachionus_calyciflorus

3. Taxonomie und Ökologie von Ciliaten (Wimpertierchen) -

http://www.ciliates.at/en/2016/01/29/coleps-hirtus-hirtus/

4. Buonanno F, Anesi A, Guella G, Kumar S, Bharti D, La Terza

A, Quassinti L, Bramucci M, Ortenzi C. Chemical offense by

means of toxicysts in the freshwater ciliate, Coleps hirtus.

Journal of Eukaryotic Microbiology. 2014 May;61(3):293-

calyciflorus

Wikipedia

04.

5. Ciliata in Wikipedia - https://en.wikipedia.org/wiki/Ciliate

6. Kützing FT. Die kieselschaligen Bacillarien oder Diatomeen.

F. Förstemann; 1865.

7. Asif M. Calcium Sensitizing and Phosphodiesterase-III

Inhibitory Activity of Pyridazine Compounds: A Review.

Journal of Chemical Reviews. 2019 Jan 1;1(1, pp. 1-77.):47-

8. Itodo AU, Itodo OM, Iornumbe E, Fayomi MO. Sorptive

chelation of metals by inorganic functionalized organic WOx–

EDA nanowires: adsorbent characterization and isotherm

studies. Progress in Chemical and Biochemical Research. 2019

Oct 18;1(1, pp. 1-59):50-9.

9. Taher MA, Damarany BK. Effect of partial substitution of raw

gypsum with thermally treated phosphogypsum on the

properties of Portland Pozzolanic Cement. Advanced Journal

1035