Phycoremediation of Paper and Pulp Mill Effluent using Planktochlorella nurekis and Chlamydomonas reinhardtii

Journal of Environmental Treatment Techniques

2020, Volume 8, Issue 2, Pages: 809-817

J. Environ. Treat. Tech.

ISSN: 2309-1185

Journal web link: http://www.jett.dormaj.com

Phycoremediation of Paper and Pulp Mill Effluent

using Planktochlorella nurekis and Chlamydomonas

reinhardtii – A Comparative Study

Praveen Kumar Chakkalathundiyil Sasi , AmbilyViswanathan , Jerry Mechery , Daniya

Mundakkal Thomas , Jomon Puthenpurakkal Jacob and Sylas Variyattel Paulose

School of Environmental Sciences, Mahatma Gandhi University, Kottayam, Kerala- 686560, India

Department of Applied Chemistry, Cochin University of Science and Technology, Kochi, Kerala- 682 022 India

Received: 16/12/2019

Accepted: 13/04/2020

Published: 20/05/2020

Abstract

In the present study, the wastewater collected from a paper and pulp mill industry was treated using two microalgae, Planktochlorella

nurekis and Chlamydomonas reinhardtii. The microalgae was grown in paper and pulp mill effluent (PPME) under natural environmental

conditions and harvested on the 12 day. Results of the study showed that both P.nurekis and C. reinhardtii could reduce nitrate (96 %

and 86%), phosphate (100% and 88%), COD (92% and 93%) and other physico-chemical parameters after the experiment. The

percentage reduction of heavy metals such as Cr, Co, Ni, Cu, Zn, As, Sr and Cd were 100%, 97%, 77%,71%, 72%, 98%, 88% and 88%

respectively by P.nurekis. Similarly the percentage reduction of the foresaid heavy metals were 100%, 46%, 44%, 49%, 68%, 57%, 86%

and 86% respectively by C. reinhardtii. The lipid content of P.nurekis was 24% and 20.5% for C.reinhardtii was after the experiment.

Comparatively, P.nurekis exhibited significantly higher phycoremediation capacity as well as lipid production potential than C.

reinhardtii. It is evident that both microalgae have the potential for the treatment of paper and pulp mill effluent and both the species

can be used as good candidates for lipid production.

Keywords: Phycoremediation, paper and pulp mill effluent, Heavy metals, Lipids, P.nurekis, C. reinhardtii

Introduction¹

[

14, 15, 16]. As an alternative, phycoremediation employing

microalgae for the removal of the nutrients from wastewater is

gaining much attention [17, 18-23]. Phycoremediation is used

to describe treatment of pollutants in a contaminated area using

micro and macroalgae [24-28].

Microalgae can be easily cultured in fresh water, marine

water, brackish water or on non-arable land. They do not

compete with agriculture for existing resources. Microalgae

utilize atmospheric carbon dioxide during their photosynthetic

process and also have proven their potential to abate

greenhouse gases. They reproduce rapidly, achieving faster

growth than any energy crop and can be harvested frequently

Globally, the paper and pulp mill industry is listed as the

sixth largest polluter among the various industries which

discharge a huge quantity of liquid, solid and gaseous wastes

into the environment [1]. Enormous volume of wastewater

(

~300 m ) is generated for the production of each metric ton of

paper depending on the nature of raw material, end product and

the extent of water reuse [2, 3, 4]. These untreated wastewater

(effluent) causes significant damage to the receiving water

bodies since they have high COD, BOD, chlorinated

compounds, suspended solids, fatty acids, tannins, resins,

acids, lignin and its derivatives, sulphur compounds etc. [1, 5,

[29]. Microalgae have many applications in the field of

, 7, 4]. Several treatment processes including removal of

pollution abatement, biofuel production and carbon

sequestration [30]. Phycoremediation is an eco-friendly low

cost technology which serves as an attractive option for

pollution control in the developing countries. The spent

biomass after phycoremediation can be used for making high

worth products such as biodiesel, biogas and other algal

metabolites [31, 21, 32].

Studies have reported the ability of microalgae in the

treatment process for the removal of nutrients from varied types

of wastewater [34-37]. However, not many studies have been

conducted on treatment of PPME using microalgae. The use of

pulp and paper mill effluent for the cultivation of microalgae is

least explored. The conventional treatment system is widely

adopted for the treatment of pulp and paper mill effluent. On

this background, an attempt has been performed to check the

suspended solids, colloidal particles, floating matters, colors

and toxic compounds by conventional and non-conventional

methods like sedimentation, flotation, screening, adsorption,

coagulation, oxidation, ozonation, electrolysis, reverse

osmosis, ultra-filtration and nano-filtration technologies etc.

are practiced [8, 9, 10, 11, 12]. The main disadvantages of these

conventional processes are high operational cost and increased

sludge production. Hence, phytotechnological approach is a

viable option for its remediation. Effective in situ

phytoremediation (use of plants) techniques have been applied

for reducing the heavy metal load from paper mill effluents [4,

1, 13]. Eventhough it seems to be promising, there are some

limitations associated with this technique. Phytoremediation

requires long term maintenance and it may be effective only

seasonally. Moreover, the remediation efficiency was very low

Corresponding author: Sylas Variyattel Paulose, School of Environmental Sciences, Mahatma Gandhi University, Kottayam, Kerala-

86560, India. Email: sylas@mgu.ac.in.

Journal of Environmental Treatment Techniques

2020, Volume 8, Issue 2, Pages: 809-817

feasibility for cultivation of microalgae such as P.nurekis and

C.reinhardtii in PPME for nutrient removal. Hence, the present

study aims to evaluate the potential of Planktochlorella sp. and

C. reinhardtii for the treatment of PPME and subsequent

production of biomass and lipid with a bio-energy perspective.

determine the optimum concentration of wastewater was

carried out (70% wastewater: 30% water). Initially, the

microalgae were subjected to the growth phase and in the

second stage, their ability to substantially reduce nitrate,

phosphate, COD and heavy metals was conducted. The

experiment was scaled up in 20L glass containers (2 nos.) with

actual working volume of 10L. Concentrated uniform

suspension (10ml) of Planktochlorella sp. and C. reinhardtii

was separately added to the concerned glass containers.

Similarly, equal volume of wastewater was taken in another set

of glass tanks without microalgae maintained as control. The

glass containers were exposed to natural sunlight and mixing

was performed manually to avoid settling of cells. The study

was conducted for 12 days in three experimental sets of

reactors. Aliquots were withdrawn from the three glass

containers for the analysis of physico-chemical parameters

before the inoculation of microalgae and subsequently at

periodic intervals of 2 days throughout the experimental period.

The supernatant obtained after centrifugation at 5000 rpm for

Material and methods

.1 Isolation and culturing of freshwater microalgae

Mixed microalgae were collected from Kuttanad wetland

ecosystem, Kerala, India and were then cultured in diluted

paper and pulp mill effluent (20 times dilution). After 7 days,

the dominant species was isolated and sub-cultured for

obtaining pure strain. The isolation and purification was done

by repeated streaking on nutrient agar plate and later cultured

in Bold and Basal medium (BBM). Composition of the medium

2.5g, K

1.75g, CaCl

HPO 0.75g, NaCl0.25g, NA

.7H +H SO4 0.498g +0.1ml,

ml trace metals mixed solution

.4H O1.810g, ZnSO .7H O0.222g,

)6H 0.0494g, CuSO .5H 0

.2H

O 0.25g, MgSO

.7H

EDTA+ KOH

was KH O 0.75g,

NaNO

+0.625g, FeSO

BO 0.25g and

BO 2.860g, MnCl

NaMOO 0.079g, CO(NO

.079g. The microalga Chlamydomonas reinhardtii was

0 min was used for the analysis of pH and COD as per the

(

standard methods of APHA (1998). Analysis of nitrate,

phosphate and sulphate were done by ion chromatography

(DIONEX ICS-1100). Heavy metal analysis was done by ICP-

obtained from Chlamydomonas resource centre, University of

Minnesota (USA). It was cultured in Tris – Acetate Phosphate

MS (Thermo iCAPRQ). The nutrient removal efficiency of

both microalgae was calculated according to following

equation.

(

TAP medium). The composition of TAP medium was 40 X

TAP 25 ml (NH Cl.15g, MgSO . 7H O 0.4 g, CaCl .2H O 2 g),

Phosphate solution 0.375 ml (K HPO 28.8 g, KH PO 14.4 g),

Hutner’s trace element 1 ml (Na EDTA. 2H O 5 g, ZnSO

. 4H O 0.5 g, FeSO .7H

0.16 g, CuSO .5H 0.16 g,

O 0.11 g), Acetic acid 1 ml, Tris buffer 2.42

(

P − P )

0 t

× 1ꢀꢀ

Removal efficiency (%) =

O 2.2 g, H

.5 g, CoCl

1.14 g, MnCl

.6H

(NH

)

24.4H

0 t

where P was the initial concentration of wastewater and P was

the concentration of wastewater after phycoremediation

process.

The isolated pure culture of microalga was subjected to

DNA isolation and PCR amplification for identification using

eukaryotic

’GGTTGATCCTGCCAGTAGTCATATGCTTG3’)

reverse primer

forward

primer

(ss5-

and

(ss3-

2.4 Microalgal Cell Counting and Biomass estimation (Dry

biomass)

Cell count method was employed for the determination of

microalgal cell growth in the culture reactors maintained under

the experimental conditions [38]. 1ml of culture medium was

taken regularly at an interval of two days and the cells were

’GATCCTTCCGCAGGTTCACCTACGGAAACC3’). The

PCR products were sequenced and the obtained partial

sequence was matched with previously published sequences in

the National Centre for Biotechnology Information (NCBI)

enumerated with the help of

a Sedgwick rafter cell.

database

using

ADVANCED

BLAST

Measurements were done in triplicate and the mean values were

represented in the results. Gravimetric method was employed

for the quantitative estimation of biomass [38]. 2ml of culture

medium was taken at an interval of two days and filtered

through a pre-weighed Whatman No:1 filter paper. It was then

(www.ncbi.nlm.nih.gov/BLAST) and the percentage similarity

with already identified 18S rRNA gene sequences in the

GenBank database were determined. Later the 18S rRNA gene

sequence of isolated microalga was submitted in NCBI

GenBank for the allocation of accession number.

oven-dried at 60 C for 1 hour and reweighed. The difference

between each observation was calculated as per the following

formula;

.2 Growth of microalgal strains and culture conditions

The isolated microalgal species was identified as

Planktochlorella sp. based on standard literature. Both

Planktochlorella sp. and C. reinhardtii were cultured in 250 ml

flasks separately in B B M and T A P medium respectively. The

Biomass (Dry weight in g) = W

2 1

-W

where, W is weight of dried filter paper after filtration and W

culture was incubated at 28±1.0 C and maintained at a light

is weight of filter paper.

-1

intensity of 25 µmol photons m

s using fluorescent tube

lights. Carbon dioxide gas was supplied at 10psi/kg for 5min

per day. Aeration was provided for preventing the settling

down of the cells at the bottom. Growth rate of

Planktochlorella sp. and C. reinhardtii were measured by using

Sedgwick rafter cell counting method [38].

2.5 Lipid extraction

Cells were harvested by centrifugation at 4500 rpm for 5

min and washed once with distilled water and oven dried. An

aliquot (20g) of the biomass was mixed with 100ml of double

distilled water and the cells were disrupted using a sonicator

(CPX130) at a resonance of 20 kHz for 5 min. This sonicated

mixture was blended with 2:1 methanol chloroform solution as

per the modified Bligh and Dryer method [39]. The mixture

was transformed into a separating funnel and shaken for 5 min.

The lipid fraction was then separated from the funnel and

evaporated using solvent in the rotary evaporator. Finally the

weight of the crude lipid obtained from each sample was

.3 Collection, characteristics and experimental setup

Paper and pulp mill effluent (PPME) was collected from

Hindustan Newsprint Ltd. factory in Kottayam district, Kerala,

India in 20L plastic containers and stored at 4 C. The collected

effluent was filtered separately and preliminary examination to

Journal of Environmental Treatment Techniques

2020, Volume 8, Issue 2, Pages: 809-817

measured using an electronic weighing balance (Shimadzu,

Japan).

and thus began to decrease in the medium. This insufficient

supply of nutrients caused the decline of biomass and cell count

after the 10 day. Microalgae growth was directly affected by

.6 Statistical analysis

Analysis of variance (ANOVA) was performed to find out

the availability of light, nutrients, temperature, the initial

inoculation density and the growth environment [40].

any significant difference in water quality parameters among

the culture reactors of Planktochlorella sp. and C. reinhardtii

with the control reactor. The mean and standard deviation

within samples were calculated for all cases. The statistical

analysis was done by using SPSS 21 version.

3.3 Physico-chemical properties of paper and pulp mill

effluent

The PPME had dark brown coloration, which might be due

to the presence of chlorinated organic compounds produced

from lignin degradation during conventional bleaching, wood

cooking and alkali extraction of the pulp [41]. The dissolved

chemicals especially mercaptans and hydrogen sulphide used

during the manufacture of paper resulted in the characteristic

pungent odour [42]. The physico-chemical parameters such as

pH, nitrate, phosphate, COD, sulphate and heavy metals (Cr,

Co, Ni, Cu, Zn, As, Sr and Cd) contents were assessed. The

paper and pulp mill effluent was slightly acidic in nature with

pH 6.02 which changed to alkaline with a pH of 8.3 after 12

days of treatment with P.nurekis and C. reinhardtii (Table 1).

The results showed that the pH of the water plays an important

role especially with respect to metabolism, survival and

microalgal growth. The pH of paper mill effluent changed from

neutral to alkaline after 12 days of growth of P. nurekis and C.

reinhardtii. The pH between 8.2 and 8.7 was favourable for the

growth of the microalgae compared to the neutral and acidic

redox-conditions. In the present study, P. nurekis showed

higher biomass in pH 8.3 (Figure.4) and C. reinhardtii showed

higher biomass in pH 7.9 (Figure.5). An increase of pH by

Results and discussion

.1 Molecular identification of microalga

The results of BLAST on the NCBI revealed that isolated

microalga exhibited 99% similarity with Planktochlorella

nurekis. The 18S rRNA gene sequence was submitted to

GenBank and designated as Planktochlorella nurekis CS18

with GenBank accession number: MG811583. Phylogenetic

tree of microalga P.nurekis shown in figure 1.

.2 Growth and biomass of the microalgae

Initially, the collected effluent was dark brown in colour

but changed to lighter shade after 12 days of microalgal

treatment. The results showed considerable increase in both

cell count and biomass of microalgal cells after the experiment.

The initial cell density of both species was 550cells/ml. After

2 days, P.nurekis showed higher cell density of 4320 cells/ml

and C. reinhardtii had 3650 cells/ml (Figure.2). At the early

stage of the experiment, the cell biomass of P.nurekis was

5.79% in industrial effluent treated with Chlorella vulgaris

.042g/L and it was 0.037g/L for C. reinhardtii (Figure.3).

was reported by Dominic et al. [43]. Vijayakumar et al. [44]

also reported pH increase (alkaline) in the dye effluent treated

with Oscillatoria sp. Studies of Wurts et al. [45] showed the

increase of carbonate and bicarbonates in water due to the

growth of algal species.

P.nurekis and C. reinhardtii showed highest biomass on the

0 day of the study period and after which the biomass of both

the species got reduced (Figure.3). The initial biomass increase

was proportional to the availability of all the required nutrients

upto the 10 day. As the cells grew, the nutrients were taken up

Figure 1: Neighbour-joining phylogenetic tree of P.nurekis isolated from the Kuttanad wetland ecosystem

Journal of Environmental Treatment Techniques

2020, Volume 8, Issue 2, Pages: 809-817

Urea and di-ammonium phosphate used in the manufacturing

processes were the source of nitrate-nitrogen and phosphate in

PPME. Wang et al. [46] obtained 62.5% removal of nitrate-N

by Chlorella sp. grown in effluent from aeration tank of

municipal wastewater treatment plant. Sivasubramanian et al.

[47] reported that 90% of nitrate was removed from soft drink

industrial effluents treated with microalgae in outdoor

cultivation.

Figure 2: Variation of cell number of P.nurekis and C. reinhardtii in

PPME

Figure 5: Variation of pH and biomass of C. reinhardtii cultivated in

pulp and paper mill effluent

Phosphorous is present almost solely as phosphates in

natural water and wastewater. At the initial stage of the

experiment, the phosphate content in PPME was 12mg/L. By

the end of the experiment, complete removal (100%) of

phosphate from PPME was achieved by P.nurekis and 88%

reduction was obtained with C. reinhardtii (Table 1).

Microalgae was able to assimilate phosphorus in excess, which

was stored in the cells in the form of polyphosphate granules,

potassium and magnesium were co-transported along with

phosphate [48]. Mirquez et al. [21] reported 70 to 83% and

Figure 3: Variation of biomass of P.nurekis and C. reinhardtii in

PPME

00% reduction of both phosphate and nitrate from municipal

wastewater by mixed microalgae and bacterial culture.

Similarly, the complete removal (100%) of phosphate from

PPME was observed after 12 days of incubation with P.nurekis

whereas, C. reinhardtii. showed 88% removal of phosphate.

The optimal inorganic N/P ratio for algal growth was suggested

to be in the range of 6.8-10 and it was found that the N/P ratio

was much more than the optimal ratio, indicating nitrogen

richness. Nevertheless, despite of richness of N/P ratio in the

effluent, microalgal growth was found significant till 10 days

of cultivation after which the growth decline. Previous studies

have reported the decrease of phosphate level in the wastewater

due to the growth of algal species [49, 50].

After the treatment process, both P.nurekis and C.

reinhardtii could reduce the sulphate in the PPME from

30mg/l to 46mg/L and 92mg/L respectively (Table 1). 80%

sulphate was removed from PPME using P.nurekis and C.

reinhardtii showed 60% removal. High amount of sulphate

were present in paper and pulp mill effluent due to sulphate

kraft process used in the formation of wood pulp and use of

sodium sulphate in the bleaching process [42]. These results are

in agreement with the studies of Azarpira et al. [51] where

more than 90% removal of sulphate in municipal wastewater

using blue green algae was observed. Similarly, Ahmad et al.

Figure 4: Variation of pH and biomass of P. nurekis cultivated in pulp

and paper mill effluent

Total oxidized nitrogen is the sum of the nitrite and nitrate

nitrogen. The amount of nitrate was found to be very high in

PPME (28mg/L) before experiment. After the experimental

period, about 96% of nitrate-N was reduced by P.nurekis and

[52] also demonstrated significant reduction of SO4 using

Chlorella and mixed algal culture. In the present study, the

6% was reduced by C. reinhardtii. Nitrogen is present in the

form of nitrate, nitrite, ammonia and organic nitrogen in the

order of decreasing oxidation state in water and wastewater.

initial COD of PPME was very high value with 9200 mgO /l.

After 12 days of treatment, significant reduction of COD was

Journal of Environmental Treatment Techniques

2020, Volume 8, Issue 2, Pages: 809-817

noted for both microalgae (Table 1). P.nurekis could remove

toxicity and also could eliminate metals through the process of

adsorption and absorption. The percentage reduction of Cr, Co,

Ni, Cu, Zn, As, Sr and Cd were 100%, 97%, 77%,71%, 72%,

98%, 88% and 88% respectively by the P.nurekis (Figure. 6).

Similarly, the percentage reduction of the foresaid heavy

metals were 100%, 46%, 44%, 49%, 68%, 57%, 86% and 86%

respectively by the C. reinhardtii (Figure. 6). No variation was

observed in the control reactors.

The metal sorption capacity depended on the type of

biosorbent, the availability of concentration of heavy metals

[57]. Heavy metal concentration was lower in pulp and paper

mill effluent. Heavy metal with lower concentration could

easily enter the cells of microalgae through micronutrient

transporters and get attached to peptides or proteins and finally

moved to specific cellular compartments for detoxification

[62]. In this study, it was noted that P.nurekis and C. reinhardtii

was more resistant to the toxicity of concentration of heavy

metals from PPME. Both microalgal species exhibited

reasonably high potential for phycoremediation for the afore

mentioned heavy metals from PPME. This may be due to the

lower concentration of heavy metals from PPME. The

statistical analysis results showed high significant variation

(p<0.01).

3% COD and C. reinhardtii could remove 92% COD from

PPME. The reduction in COD is caused by the rapid

biodegradation and bioconversion of organic matter due to the

growth of microalgae [53]. A total of 98% reduction of COD

from sewage water was reported by Ahmad et al. [52] in a

comparative study of removal of organic and inorganic matter

from sewage water using different species of algae like

Spirogyra, Chlorella etc. Elumalai et al. [54] also observed

substantial decrease in COD in textile wastewater after treating

with Chlorella and Scenedesmus sp. revealed that algal

consortium was more efficient. Microalgae released oxygen to

the surrounding water during photosynthesis, which is used for

the oxidation of organic matter simultaneously reducing the

demand of oxygen in the growing medium [55]. Compared to

other studies, the present study proved that the proposed

microalgae have the potential to remediate the effluent from

pulp and paper mill industry (Table 2). The statistical analysis

results of COD showed high significant variation (p<0.01).

While parameters like nitrate, phosphate and sulphate had

shown significance at 0.05 level (p<0.05). The Bonferroni post

hoc test showed that the significant variation in nitrate,

phosphate, sulphate and COD among P.nurekis and control

samples at 0.05 level of significance (p<0.05).

.4 Removal of heavy metals from PPME by P.nurekis and

C. reinhardtii

Green microalgal cells cultured in wastewater with high

heavy metals are known to accumulate higher concentrations

of metal [56]. In the present study, heavy metals like Cr, Co,

Ni, Cu, Zn, As, Sr and Cd were analysed by ICP-MS. The initial

concentration of Cr in the PPME was 0.129 ppb. After 12 day

of the experiment, both P. nurekis and C. reinhardtii (Figure.6)

showed complete removal of Cr. The amount of Co in PPME

was 0.208 ppb. Nearly 97% Co was removed by P. nurekis

whereas C. reinhardtii could remove about 46%. Chlorella

could efficiently reduce 76%-96% of Cd and 78%-94% of Ni

from the medium within 7-28 days when cultured under

laboratory condition [57]. The initial value of Ni in PPME was

.95ppb and was reduced to 0.22 ppb and 0.52 ppb by P.

nurekis and C. reinhardtii, respectively. The initial

concentration of Cu was 14.6ppb. Both P.nurekis and C.

reinhardtii showed comparatively less reduction of Cu i.e. 71%

and 49%, respectively. About 72% of Zn was removed by

P.nurekis and C. reinhardtii could remove 68%. Scenedesmus

bijuga and Oscillatoria quadripunctulata showed heavy metal

removal capacity with 37-50% for Cu, 20-33% for Co, 35-

Figure 6: Heavy metals (ppb) removal of P.nurekis and C. reinhardtii

in PPME before and after treatment

3.5 Lipid content – A bioenergy perspective

Lipids are the substances that are insoluble in water, related

biosynthetically or functionally to fatty acids and their

derivatives. The biodiesel production from the lipid content of

microalgae is a promising technology [72] and is considered as

carbon neutral [30]. Lipid content obtained from P.nurekis was

24% and that from C. reinhardtii was 20.5% lipid (Table 3).

Comparatively, P.nurekis showed higher yield of lipid than C.

reinhardtii (Figure.7). Malla et al. [73] reported 20.69% and

28.32% total lipid content when C.minutissima was grown on

IARI and CETP wastewater. Dried biomass is typically a pre-

requisite for biodiesel production from microalgae as moisture

interferes with the base homogenous catalyst used in the trans-

esterification reaction [74]. In order to prevent the denaturation

of the intracellular lipid, a low temperature (typically less than

00% for Pb and 32-100% for Zn from the sewage and

petrochemical industry effluent [58].

Maximum reduction of As concentration in PPME was

done by P.nurekis (98%) while it was 57% for C. reinhardtii.

The initial Sr concentration was 390.2 ppb and P.nurekis

(Figure. 6) showed 88% reduction of Sr content in PPME while

it was 86% reduction by C. reinhardti (Figure.6). After 12 days

of the experiment, Cd concentration was reduced from 1.05ppb

to 0.13ppb by P.nurekis and to 0.12ppb by C. reinhardtii. The

removal efficiency of the heavy metal from wastewater by

microalgae depended on their large surface area and high

binding affinity [59]. It was noted that the reactor of P.nurekis

performed higher ability to consume heavy metals from PPME.

Wang et al. [60] revealed that heavy metals like Al, Ca, Fe, Mg

and Mn could be removed efficiently by Chlorella sp. from

municipal wastewater. Saunders et al. [61] observed that

phycoremediation potential of three species of microalgae

cultivated in wastewater polluted with heavy metals from coal-

fired power plant. All species accumulated high concentrations

of heavy metals. Microalgae are very responsive to heavy metal

100 C) is used to dry the biomass [75]. In the study, the algal

biomass was subjected to oven dry at 80 C until the water

content got evaporated and the lipid was weighed. Hempel et

al. [76] reported that Chlorella sp.589 achieved 30.2% lipid,

Chlorella sp.800 achieved 24.4% lipid and Chlorella

saccharophila 477 achieved 27.6% lipid. A comparative

analysis of the lipid content obtained from the present study to

the other reported studies is given in Table 3.

Journal of Environmental Treatment Techniques

2020, Volume 8, Issue 2, Pages: 809-817

Table 1: Physico-chemical characters of PPME during the study period

Parameters

unit)

Initial

values

Period of experiment (days)

th th

Experiment reactor

2ⁿ^dday

6.5 ± 0.15

6.5± 0.32

6.2±0.1

4^t^hday

7.1± 0.2

6.9± 0.41

6.4±0.2

day

8 day

10^t^hday

8.2 ± 0.1

7.9± 0.51

6.9±0.2

12^t^hday

8.3± 0.2

8.3± 0.72

6.8±0.3

(

P.nurekis

C. reinhardtii

Control

7.4 ± 0.1

7.2± 0.45

6.7±0.1

7.9± 0.20

7.5±0.53

6.8±0.3

.02

P.nurekis

C. reinhardtii

Control

P.nurekis

C. reinhardtii

Control

P.nurekis

C. reinhardtii

Control

P.nurekis

C. reinhardtii

Control

18.4 ± 0.23

19.8± 0.15

21.4±0.73

6.0± 0.15

6.4± 1.57

7.7±0.12

190±1.52

202± 1.36

224±1.5

12± 0.54

15± 0.23

20.7±0.8

4.1± 0.20

5.2±1.24

7.4±0.13

153 ± 1.39

184± 1.52

216±1.6

9.6 ± 0.23

10± 0.32

20.0±0.62

2 ± 0.25

4.1± 1.36

6.9±0.39

118±1.23

175± 1.45

210±2.1

4.8 ± 0.45

7±0.36

1.1 ± 0.52

5± 0.02

0.98 ± 0.95

3.2± 0.02

18.8±0.42

0.0

Nitrate(ppm)

19.8±0.53

1.0 ± 0.13

3.7± 1.24

6.5±0.43

88 ± 1.51

152± 1.67

205±2.2

1125 ± 6.84

4320± 2.63

10990±3.1

19.2±0.71

0.4 ± 0.01

2.9± 1.12

6.1±0.53

63 ±1.64

120± 1.62

198±0.92

804± 2.46

2100± 3.64

10980±2.1

Phosphate(pp m)

Sulphate(ppm)

1± 0.90

6.0±0.91

46 ±1.12

92± 1.23

195±0.96

800± 2.38

900± 1.22

10985±2.2

230

9200

8125 ± 7.63

9045± 6.36

11155±3.1

6200 ± 5.24

8630± 5.12

11100±3.5

4350 ± 4.23

6240± 5.73

11000±3.4

COD (mgO

/L)

Table 2: Wastewater removal efficiency of different treatment methods used in pulp and paper mill industries

COD

Methods

Technology/ organism used

Days

EC (%)

TDS (%)

Nitrate (%)

Phosphate (%) Sulphate (%)

Reference

(

Anaerobic process

Aerobic process

Hybrid system

Anaerobic reactor

57.1

90.06

50.5

81.8

57.5

91.94

93.8

91.36

90.4

91.68

49.89

40.5

74.66

92.96

57.2

[63]

[64]

[65]

[66]

[13]

[4]

[67]

[68]

[42]

[69]

[70]

[71]

Present study

Membrane bioreactor

USAB electrochemical

Heterogeneous catalyst

Lemna minor

Trapa natans L.

Vallisnaria spiralis

Eichhornia crassipes

Pleurotus spp.

Chlamydomonas reinhardtii

Mixed culture of Scenedesmus sp.

Planktochlorella nurekis

Chlamydomonas reinhardtii

nda

2 hr

Wet air oxidation

Phytoremediation

Phycoremediation

90.1

91.7

87.8

47.69

93.18

95.6

85.6

90.71

71.2

100

87.5

92.8

91.9

Nr – not reported, nda- no data available

Journal of Environmental Treatment Techniques

2020, Volume 8, Issue 2, Pages: 809-817

Table 3: Comparison of Lipid produced with previous studies

Sl. No.

Species

Chlorella vulgaris

Chlorella sp.

Lipid Content (%)

14- 50

13.6

14-22

2.0

19.0–22.0

9.68

19.29

30.0

31.0

25.25

18.10

References

[77]

[46]

[78]

[79]

[80]

[81]

[82]

[83]

[84]

[85]

[86]

[87]

Present study

C.vulgaris

C. pyrenoidosa

C. sorokiniana

C. fusca

N. vigensis

Ankistrodesmus sp.

Scenedesmus sp.

Chlamydomonas reinhardii

C. saccharophila

Scenedesmus obliquus

P.nurekis

12-14

22.0

20.0

C. reinhardtii

research fellowship as UGC – RGNF. Thanks are also to Dr.

A.P. Thomas, Director, Advanced Centre for Environmental

Sciences and Sustainable Development and Director, IUIC

(DST-SAIF) Mahatma Gandhi University, Kerala India for

providing research help. The authors are also thankful to

KSCSTE – SARD and DST-FIST for the support to the present

work.

Ethical issue

The authors are aware of and comply with the best practices

in publication ethics specifically with regard to authorship

(avoidance of guest authorship), dual submission, manipulation

of figures, competing interests and compliance with policies on

research ethics. The authors adhere to publication requirements

that submitted work is original and has not been published

elsewhere in any language.

Figure 7: Lipid content of P.nurekis and C. reinhardtii

Competing interests

The authors declare that there is no conflict of interest that

would prejudice the impartiality of this scientific work.

after experiment

Conclusions

Paper and pulp mill effluent contains large amount of

Authors’ contribution

organic and inorganic nutrients. The study indicated that the

treatment of PPME by microalgae is very efficient. Based on

the results of the physico-chemical analysis, P.nurekis could

significantly reduce nitrate, phosphate, sulphate, COD etc.

from PPME. The percentage reduction of Cr, Co, Ni, Cu, Zn,

As, Sr and Cd were 100%, 97%, 77%,71%, 74%, 98%, 88%

and 88% respectively by the P.nurekis. Similarly the

percentage reduction of the foresaid heavy metals were 100%,

All authors of this study have a complete contribution for

data collection, data analyses, and manuscript writing

References

[

1] Ali M, Sreekrishnan TR. Aquatic toxicity from pulp and paper mill

effluents: A review. Adv. Environ. Res. 2001; 5:175-196.

2] Thompson G, Swain J, Kay M, Forster CF. The treatment of pulp

and paper mill effluent: a review. Bioresour Technol 2001; 77:

275-286.

[

6%, 44%, 49%, 68%, 57%,86% and 86% respectively by the

C. reinhardtii. At the end of the experiment, 24% of lipid was

obtained from P.nurekis and 20.5% lipid was obtained from C.

reinhardtii. Comparatively, P.nurekis showed higher yield of

lipid than C. reinhardtii. It could be concluded that the

indigenous microalgae, P.nurekis and C. reinhardtii have

immense phycoremediation capacity for the treatment of paper

and pulp mill effluent. Comparatively P.nurekis exhibited

significant phycoremediation capacity as well as lipid

production potential than C. reinhardtii. The subsequent

biomass and lipid can be used for the production of valuable

products such as biodiesel. Considering the short period of time

and low external inputs, phycoremediation is a viable option

for the treatment of paper and pulp mill effluent.

[3] Garg A, Narayana VVVS S, Chaudhary, P, Chand S. Treatment

of pulp and paper mill effluent J Sci Industr Res. 2004; 63: 667-

71.

4] Kumar V, Chopra AK. Reduction of pollution load of paper mill

effluent by phytoremediation technique using water caltrop

Trapa natansL.). Cog Environ Sci. 2016; 2: 1-12.

5] Bishnoi NR, Khumukcham RK, Kumar R. Biodegradation of

pulp and paper mill effluent using anaerobic followed by aerobic

digestion. J Environ Bio 2006; 27(2): 405- 408.

[

(

[6] Sureshvarr K, Bharathiraja B, Jayakumar M, Jayamuthunagai J,

Balaji L. Removal of azo dye compounds from paper industries

wastes using phytoremediation methodology. Int

010. 8 (1): 687-700.

J Chem Sci.

[

7] Razali MAA, Ahmad Z, Ariffin A. Treatment of Pulp and Paper

Mill Wastewater with Various Molecular Weight of

PolyDADMAC Induced Flocculation with Polyacrylamide in the

Hybrid System. Adv in Chem Eng and Sci. 2012; 2: 490-503.

8] Azimvand J, Mirshokraie SA. Assessment of physico-chemical

characteristics and treatment method of Paper Industry Effluents :

a review. Intl Res J Appl Basic Sci 2016; 10 (1): 32-43.

Acknowledgement

The authors are thankful to University Grants Commission

(UGC), New Delhi, India [F.41/2012 (SR)] for the financial

support. Author (PKCS) is thankful to UGC for providing

Journal of Environmental Treatment Techniques

2020, Volume 8, Issue 2, Pages: 809-817

[

9] Ashrafi O. Yerushalmi L. Haghighat F. Wastewater treatment in the

pulp and paper industry: A review of treatment process and the

associated greenhouse gas emission. J of Env Manag. 2015; 158:

[31] Ji M, Abou-Shanab RAI, Kim S, Salama E, Lee S, Kabrad

AN, Lee Y, Hong S, Jeona B. Cultivation of microalgae species

in tertiary municipal wastewater supplemented with CO2 for

nutrient removal and biomass production. Ecol Eng. 2013; 58: 142

–148.

[32]Chandra R, Amit, Ghosh UK. Effects of various abiotic factors on

biomass growth and lipid yield of Chlorella minutissima for

sustainable biodiesel production. Environ Sci Pollut Res. 2018; 1-

14.

[33]Apandi N, Mohamed RMSR,, Al-Gheethi A, Latiffi A, Arifin

SNH, Gani P. Phycoremediation of Heavy Metals in Wet Market

Wastewater. : Ear. and Environ.Sci. 2017;140: 1-6.

[34] Gani P, Sunar NM, Matias-Peralta H, Latiff AAA, Parjo UK,.

Razak ARA. Phycoremediation of Wastewaters and Potential

Hydrocarbon from Microalgae: A Review Adv. in Env. Bio.

2015; 9:20, 1-8.

[35] Segura MB, Rodríguez LH, Ospina DP, Bolaños AV, Pérez K.

Using Scenedesmus sp. for the Phycoremediation of Tannery

Wastewater. Tecciencia. 2016; 69-75.

[36] Singh AK, Sharma N, Farooqi H, Abdin MZ, Mock T Kumar S.

Phycoremediation of municipal wastewater by microalgae to

produce biofuel, Inter J of Phyto. 2017; 19(9): 805-812.

[37] Nayak JK and Ghosh UK. Post treatment of microalgae treated

pharmaceutical wastewater in photosynthetic microbial fuel cell

(PMFC) and biodiesel production. Bioma and Bioene. 2019; 131:

1-10.

[38] Bellinger EG, Sigee DC. Freshwater Algae Identification and Use

as Bioindicator John Wiley and Sons London: 2010; 2-40.

[39] Bligh EG, Dyer WJ. ARapid Method for Total Lipid Extraction

and Puri fication. Cana J Biochem P hysio . 1959; 110-115.

[40] Ding J, Zhao F, Cao Y, Xing L, Liu W, Mei S, Li S. Cultivation

of microalgae in dairy farm wastewater without sterilization. Int J

Phytoremediation. 17 (1-6) : 222-7.

[41] Ali Z, Rahman M. Physico-chemical characteristics of pulp and

paper mill effluent. Res. and Environ. Life Sci. 2008;1:59 –60.

[42] Mishra, S., Mohanty, M., Pradhan, C., Patra , H.K., Das, R.,

Sahoo, S. Physico-chemical assessment of paper mill effluent

and its heavy metal remediation using aquatic macrophytes—a

case study at JK Paper mill, Rayagada, India.Environ.Monit.

Assess. 2013; 185: 4347–4359.

46-157.

[

10] Saravanan V.Sreekrishnan TR. Bio-physico-chemical treatment

for removal of colour from pulp and paper mill effluents. J Scient.

And Industr. Resear. 2005; 64:61-64.

11]

Kumar

BA,

Jothiramalingam

ThiyagarajanSK,

Hidhayathullakhan T., Nalini R. Phytoremediation of heavy metals

from paper mill effluent soil using Croton sparsiflorus. Inte Lett of

Chem Phy and Astro. 2014; 36: 1-9.

[

12] Hossain K. Ismail N. Bioremediation and Detoxification of Pulp

and Paper Mill Effluent: A Review. Res J Environ Toxicol. 2015;

(3): 113-134.

13] Ali Z, Siddiqui A. Analysis of Paper Mill Effluent (Wastewater)

and its Phytoremediation of Free Floating Macrophytes (Lemna

minor). Res J Chem Environ Sci. 2016; 4: 08-12.

14]

Doran PM. Application of Plant Tissue Cultures in

Phytoremediation Research: Incentives and Limitations.

Biotechnol Bioeng. 2009;103: 60–76.

15] Oh K, Cao T, Li T, Cheng H. Study on Application of

Phytoremediation Technology in Management and Remediation of

Contaminated Soils. J of Cle Ener Techno. 2014; 2: 216-220.

16] Pradhan S, Al-Ghamdi SG, Mackey HR. Greywater treatment by

ornamental plants and media for an integrated green wall system.

Inter.Biodet. & Biodeg. 2019; 145: 1-9.

17] Rasoul-Amini S, Montazeri-Najafabady N, Shaker S, Safari A,

Kazemi A, Mousavi P, Mobasher MA, Ghasemi Y. Removal of

nitrogen and phosphorus from wastewater using microalgae free

cells in bath culture system. Biocat and Agri Biotech. 2014; 3:

26 –13.

[

18] Ajayan KV, Selvaraju M, Unnikannan P, Sruthi P.

Phycoremediation of Tannery Wastewater Using Microalgae

Scenedesmus Species Int J Phytoremediation. 2015;17(10):907-

[

19] Whitton R, Mevel AL, Pidou, M, Ometto, F, Villa R, Jefferson B.

Influence of microalgal N and P composition on wastewater

nutrient reme diation Water R esearch. 2016; 91: 371-378.

20] Balaji S, Kalaivani T, Sushma B, Pillai CV, Shalini

M, Rajasekaran C. Characterization of sorption sites and

differential stress response of microalgae isolates against tannery

effluents from ranipet industrial area-An application towards

phycoremediation. Int J Phytoremediation. 2016; 18(8):747-53.

21] Mirquez LD, Filipa L, Behnam T, Dominique P, Nitrogen and

phosphate removal from wastewater with a mixed microalgae and

bacteria culture. Biotech Reports. 2016; 11: 18 – 26.

22] Junping LV, Feng J, Liu Q, Xie S. Microalgal Cultivation in

Secondary Effluent:Recent Developments and Future Work. Int J

Mol Sci. 201 7; 79: 1-18.

23] Ajayan KV, Harilal CC, Selvaraju M. Phycoremediation resultant

lipid production and antioxidant changes in green microalgae

Chlorella Sp. Int J Phytoremediation. 2018; 20(11):1144-1151.

24] Pathak VV, Singh DP, Kothari R Chopra AK. Phycoremediation

of textile wastewater by unicellular microalga Chlorella

pyrenoidosa .Cell Mol Biol. 2014; 60(5): 35-40.

25] Amit, Ghosh UK. An approach for phycoremediation of different

wastewaters and biodiesel production using microalgae. Environ

Sci Pollut Res. 2018.

26] Bansal A, Shinde O, Sarkar S. Industrial Wastewater Treatment

Using Phycoremediation Technologies and Co-Production of

Value-Added Products. J Bioremediat Biodegrad. 2018; 9:1.

27] Kumar PK, Krishna SV, Verma K, Pooja K, Bhagawan D,

Himabindu V. Phycoremediation of sewage wastewater and

industrial ﬂue gases for biomass generation from microalgae. Sou.

Afri. J. of Chem. Eng. 2018; 25 : 133-146.

[43] Dominic VJ, Murali M, Nisha MC.

Phycoremediation

Efficiency Of three micro algae Chlorella vulgaris, Synechocystis

salina and Gloeocapsa gelatinosa. Acade Rev. 2009;138-146.

[44] Vijayakumar S, Thajuddin N, Manoharan C. Role of

cyanobacteria in the treatment of dye industry effluent. Pollu

Res. 2005; 24 (1): 69 -74.

[45] Wurts WA, Durborow RM. 1992. Interactions of pH, Carbon

Dioxide, Alkalinity and Hardness in Fish Ponds. SRAC

Publication No. 464.

[46] Wang LM, Min L., Yecong C, Paul C, Yifeng. Cultivation of

green algae Chlorella sp. in different wastewaters from municipal

wastewater treatment plant. Appl Biochem Biotechnol. 2010; 162

(4): 1174-86.

[47] Sivasubramanian V, Subramanian VV, Muthukumaran M.

Phycoremediation of effluent from a soft drink manufacturing

industry with a special emphasis on nutrient removal–a laboratory

study. J Algal Biomass Utln. 2012; 3(3) :21–29.

[48] Bitton G (1990) Wastewater Microbiology. 3rd edn Wiley-Liss,

New York.

[49] Znad H, D Al Ketife AM, Judd S, AlMomani F, Vuthaluru HB.

Bioremediation and nutrient removal from wastewater by

Chlorella vulgaris. Ecolog Eng. 2018; 110: 1-7.

[50] Linares LCF, Barajas CG, Páramo ED. Assessment of Chlorella

vulgaris and indigenous microalgae biomass with treated

wastewater as growth culture medium. Bioresour Techno. 2017;

244: 400-406.

[51] Azarpira H, Behdarvand P, Dhumal K, Pondhe G. Comparative

studies on phycoremediation of sewage water by using blue green

algae. Inter J Bio 2014; 58-64.

[

28] Sunday ER, Uyi OJ, Caleb OO. Phycoremediation: An Eco-

Solution to Environmental Protection and Sustainable

Remediation. Journal of Chemical, Environmental and Biological

Engineering; 2(1): 5-10.

[

29] Chisti Y. Biodiesel from microalgae beats bioethanol. Trends

Biotecnol. 2008; 26: 126-131.

30] Thomas DM, Mechery J, Paulose SV. Carbon dioxide capture

strategies from flue gas using microalgae: a review. Environ Sci

Pollut Res. 2016; 23: 16926–16940.

[52] Ahmad F, Khan Khan,

AUYasar,

A. Comparative

phycoremediation of sewage water by various species of algae. Pro

Paki Aca of Sci. 2013; 50: 131-139.

[53] Abdel-Raouf N, Al-Homaidan AA, Ibraheem IBM.. Microalgae

and wastewater treatment. Saudi J Bio Sci. 2012;19: 257-275.

Journal of Environmental Treatment Techniques

2020, Volume 8, Issue 2, Pages: 809-817

[

54] Elumalai S, Saravanan GK, Ramganesh S, Sakhtival R,

Prakasam V. Phycoremediation of textile dye industrial effluent

from tirupur district, Tamil Nadu, India Int J Sci Innova Dis.

[75] Zhang X, Rong J, Chen H, He C, Wang Q. Current status and

outlook in the application of microalgae in biodiesel production

and environmental protection. Front Ener Res. 2014; 2: 32.

[76] Hempel N, Petrick I, Behrendt F. Biomass productivity and

productivity of fatty acids and amino acids of microalgae strains

as key characteristics of suitability for biodiesel production. J

Appl Phycol. 2012; 24: 1407–1418.

013; 3: 31-37.

55] Acién FG, Gómez-Serrano, Morales-Amaral MM, Fernández

Sevilla, JM, Molina Grima E. Wastewater treatment using

microalgae: how realistic a contribution might it be to significant

urban wastewater treatment?. Appl Microbiol Biotechnol.

[77]

Gouveia L, Oliveira AC. Microalgae as a raw material for

016;100 (21): 9013–9022.

biofuels production. J Ind Microbiol Biotechnol. 2009; 36: 269-

74.

[78] Demirbas D. Importance of algae oil as a source of biodiesel.

Energ Convers Manage. 2010; 52: 163–170.

[

56] El-Sheekh MM, Farghl MM, Galal HR, Bayoumi HS.

Bioremediation of different types of polluted water using

microalgae. Rend Fis Acc Lincei. 2016; 27: 401–410.

57] Rehman A, Shakoori AR. Tolerance uptake of cadmium and nickel

by Chlorella sp. isolated from tannery effluents. Pakistan J Zool.

[79] Ghasemi Y, Rasoul-Amini S, Naseri AT, Montazeri-Najafabady

N, Mobasher MA, Dabbagh F. Microalgae biofuel potentials

(Review). Appl Biochem Microbiol. 2012; 48: 126.

004; 36(4): 327-331.

58] Ajayan KV, Selvaraju M, Thirugnanamurthy K. Growth and

heavy metal accumulation potential of microalgae grown in

sewage waste water and petrochemical effluents. Pak J Biol Sci.

[80]

Ngoc LDB, Adenan MF, Bato BA, Mansor N, Mahadzir

S. Biomass and Lipid Yield of Locally Isolated Microalgae. Inter

J Chem Eng Appli. 2013; 4 (4): 262-265.

011;14(16): 805-811.

[81] Aravantinou AF, Theodorakopoulos MA, Manariotis ID.

Selection of microalgae for wastewater treatment and potential

lipids production.Bioresour Techno 2013; 147: 130–134.

[82] Sukkrom K, Bunnag B, Pavasant P. Enhancement of Lipid

Production from Ankistrodesmus sp. Int J Chem Eng and Appl.

2015; 6 (2): 111-114.

[83] Xin L, Hong-ying H, JiaY. Lipid accumulation and nutrient

removal properties of a newly isolated freshwater microalga,

Scenedesmus sp. LX1, growing in secondary effluent. Nw

Biotech. 2010; 27 (1): 59–63.

[84] Kong QX, Li L, Martinez B, Chen P, Ruan R. Culture of

microalgae C. reinhardtii in wastewater for biomass feedstock

production.Appl Biochem Biotechnol. 2010; 160: 9–18.

[85] Chinnasamy S, Bhatnagar A, Hunt RW, Das KC. Microalgae

cultivation in a wastewater dominated by carpet mill effluents for

biofuel applications. Bioresour Technol. 2010; 101: 3097–3105.

[86] Bruton T, Lyons H, Lera Y, Stanley M, BoRasmussen M. A

review of the potential of marine algae as a source of biofuel in

Ireland. Sustainable Energy, Ireland. 2009; 88.

[

59] Roy D, Greenlaw PN, Shane BS. Adsorption of heavy metals

by green algae and ground rice hulls. J Environ Sci Health Part A.

993; 28: 37–50.

60] Wang LM, Min L., Yecong C, Paul C, Yifeng. Cultivation of

green algae Chlorella sp. in different wastewaters from municipal

wastewater treatment plant. Appl Biochem Biotechnol. 2010; 162

(4): 1174-86.

[

61] Saunders RJ, Paul NA, Hu Y, de Nys R. Sustainable sources

of biomass for bioremediation of heavy metals in wastewater

derived from coal-fired power generation. PLoS ONE 2012; 7 (5):

-8.

62] Liu. J, Sun Z, Gerken H. Potential Applications of Microalgae in

Wastewater Treatments. Recent Advances in Microalgal

Biotechnology OMICS Group eBooks. Foster City, USA 2016; 9-

[

63] Singh, Thakur IS. Colour removal of anaerobically treated pulp

and paper mill effluent by microorganisms in two steps bioreactor.

Bioresour Techno. 2006; 97: 218-223.

64]Lerner M, Stahl N, Galil NI. Comparative study of MBR and

activated sludge in the treatment of paper mill wastewater. In

Forest industry wastewaters VIII IWA publishing, London,

United Kingdom, 2007; 23-29.

[

65] Buzzini AP, Pires EC. Evaluation of upflow anerobic sludge

blanket reactor with partial recirculation of effluent used to treat

wastewaters from pulp and paper plants. Bioresour Techno. 2007;

8: 1838-1848.

66] Garg A, Narayana VVVS S, Chaudhary, P, Chand S.

Treatment of pulp and paper mill effluent Sci Industr Res.

004; 63: 667-671.

67] Singhal V, Kumar A, Rai JPN. Phytoremediation of pulp and

paper mill distillery effluents by channel grass (Vallisneria

spiralis). J of Scient And Indstr Reaser. 2003; 62: 319-328.

68] Kaushal J, Bhardwaj P. Potential of Eichhorniacrassipes and

Lemna minor for degrading Pulp and Paper Mill Effluent using

Phytoremediation technique along with enhancers. Int J of Adv

Reser in Sci and Eng. 2017; 6: 1924-1932.

[

69] Ragunathan R, Swaminathan K . Biological treatment of a pulp

and paper industry effluent by Pleurotus spp. Worl J of Micro &

Biotech. 2004; 20: 389–393.

70] Ferdowshi Z. 2013. Screening of fresh water microalgae and

Swedish pulp and paper mill wastewaters with the focus on high

algal biomass production. Chalmers university of technology

Gothenburg, Sweden.

[

71] Usha MT, Chandra TS, Sarada R, Chauhan VS. 2016. Removal

of nutrients and organic pollution load from pulp and paper mill

effluent by microalgae in outdoor open pond. Bioresour Techno.

72] Chisti Y. Biodiesel from microalgae. Biotechnol . adv. 2007; 25:

[

94–306.

73] Malla FA. Khan AS. Rashmi. Sharma GK. Gupta N. Abraham

G. Phycoremediation Potential of Chlorella minutissima on

primary and tertiary treated wastewater for nutrient removal and

biodiesel production. Ecolo.Eng. 2015; 75: 343-349.

[

74] Sukhija PS, Palmquist DL. Rapid method for determination of

total fatty acid content and composition of feedstuffs and feaces. J

Agric Food Chem. 1988; 36: 1202–1206.